| CARD ID | 2827 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Mpsttm1 | |
| Internal Code | C57BL/6J-Mercaptopyruvate sulfurtranferase (targeted mutation 1) | |
| Submitter | ISHII ISAO | |
| Submitter affiliation or code | Showa Pharmaceutical University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
Collaboration with Prof. Isao Ishii at Showa Pharmaceutical University. Concession to the third person is prohibited. |
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Showa Pharmaceutical University |
| Organization code | ||
| Developer | Isao Ishii | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Mpst |
| Gene name | Mercaptopyruvate sulfurtransferase |
| Allele symbol | Mpstem1 |
| Allele name | Mercaptopyruvate sulfurtransferase, endonuclease-mediated mutation 1, |
| MGI | MGI:2179733, |
| Chromosome | 15 (37.47) (E2|15) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Mpst-3 | GCATATAAGGCCAGCACACG |
| Mpst-7 | AGCTGGGCTACATCTTAGAGA |
| Author | Akahoshi, N., Minakawa, T., Miyashita, M., Sugiyama, U., Saito, C., Takemoto, R., Honda, A., Kamichatani, W., Kamata, S., Anan, Y., Ishii, I. |
| Title | Increased Urinary 3-Mercaptolactate Excretion and Enhanced Passive Systemic Anaphylaxis in Mice Lacking Mercaptopyruvate Sulfurtransferase, a Model of Mercaptolactate-Cysteine Disulfiduria. |
| Journal | Int J Mol Sci |
| Volume | 21 |
| Page | 818; doi:10.3390/ijms21030818 |
| Year | 2020 Jan 27 |
| PMID |
| Disease name, Applicable field | Behavior, Metabolism |