CARD ID | 2353 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK-C2cd4ctm1(KOMP) | |
Internal Code | C2cd4c deficient mice | |
Submitter | Kume Shoen | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Tokyo Institute of Technology |
Organization code | ||
Developer | Shoen Kume | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | C2cd4c |
Gene name | C2 calcium-dependent domain containing 4C |
Allele symbol | C2cd4ctm1(KOMP) |
Allele name | C2 calcium-dependent domain containing 4C, targeted mutation 1, |
MGI | MGI:2685084, |
Chromosome | 10 (39.72) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | MicroInjection |
OMIM |
C2cd4c forward | gtgctcagcgtgatcctaca |
C2cd4c reverse | ccgaagtcgttccaagaacc |
C2cd4c null | ccacaacgggttcttctgtt |
Disease name, Applicable field | Molecular biology, Development, Laboratory-animal Science, Cell biology, Genetics, Obesity, Diabetes, Neurobiology, Reproduction, Digestive Disorders, Otorhinology |