CARD ID | 2746 | |
Type of strain | Gene trap. | |
Strain name | B6;CB-Erdr1Gt(pU-21W)347Card | |
Internal Code | Ayu21-W347 | |
Submitter | Araki Kimi | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | IRDA, Kumamoto University |
Organization code | Card | |
Developer | Kimi Araki | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Erdr1 |
Gene name | erythroid differentiation regulator 1 |
Allele symbol | |
Allele name | |
MGI | MGI:2384747, |
Chromosome | Y , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Z-1 | GCGTTACCCAACTTAATCG |
Z-2 | TGTGAGCGAGTAACAACCCG |
Author | Kei-ichiro Ishiguro, Kumi Matsuura, Naoki Tani, Naoki Takeda, Shingo Usuki, Mariko Yamane, Michihiko Sugimoto, Sayoko Fujimura, Mihoko Hosokawa, Shinichiro Chuma, Minoru S.H. Ko, Kimi Araki and Hitoshi Niwa |
Title | MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells |
Journal | Developmental Cell |
Volume | |
Page | |
Year | |
PMID |
Disease name, Applicable field |
EGTC番号 | 21-W364 |