CARD ID | 466 | |
Type of strain | Targeted mutant. | |
Strain name | B6;129-Dullardtm1Imeg | |
Internal Code | - | |
Submitter | Nishinakamura Ryuichi | |
Submitter affiliation or code | Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Division of Intergrative Cell Biology, IMEG, Kumamoto University |
Organization code | ||
Developer | Ryuichi Nishinakamura | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Dullard |
Gene name | Dullard homolog (Xenopus laevis) |
Allele symbol | |
Allele name | |
MGI | MGI:1914431, |
Chromosome | 11 (B4 band) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Du15783s, Du16012as ; mixture of 25 micro M each | GTTCTTGGGACACCGTCTGT, AGTCCTGCCTCTTCACCAGA |
neo β c KO, Du-2 ; mixture of 25 micro M each | "GCGTTGGCTACCCGTGATAT, TTACAGGTATGGGGGATTGG" |
Author | |
Title | |
Journal | |
Volume | |
Page | |
Year | |
PMID |
Author | Tanaka SS, Nakane A, Yamaguchi YL, Terebayashi T, Abe T, Nakao K, Asashima M, Steiner KA, Tam PP, and Nishinakamura R |
Title | Dullard/Ctdnep1 modulates WNT signaling activity for the formation of primordial germ cells in the mouse embryo. |
Journal | PLoS One |
Volume | 8(3) |
Page | e57428 |
Year | 2013 |
PMID |
Disease name, Applicable field | Development |