CARD ID | 2671 | |
Type of strain | Targeted mutant. | |
Strain name | DBA/2JJcl-Vps13atm1Asan | |
Internal Code | DBA-ChAc | |
Submitter | Sano Akira | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Kagoshima University Graduate School of Medical and Dental Sciences |
Organization code | ||
Developer | Akira Sano | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Vps13a |
Gene name | vacuolar protein sorting 13A |
Allele symbol | Vps13atm1Asan |
Allele name | vacuolar protein sorting 13A, targeted mutation 1, Akira Sano |
MGI | MGI:2444304, |
Chromosome | 19 (11.71) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
wild-F | ACAATGCCAAGAGAATAGAGTT |
Neo-F | TTGTCAAGACCGACCTGTCC |
intR-S | GGGCCCCTAATGAAGAGAAA |
Author | Sakimoto H, Nakamura M, Nagata O, Yokoyama I, Sano A |
Title | Phenotypic abnormalities in a chorea-acanthocytosis mouse model are modulated by strain background. |
Journal | |
Volume | |
Page | |
Year | |
PMID |
Author | Tomemori Y, Ichiba M, Kusumoto A, Mizuno E, Sato D, Muroya S, Nakamura M, Kawaguchi H, Yoshida H, Ueno S, Nakao K, Nakamura K, Aiba A, Katsuki M, Sano A. |
Title | A gene-targeted mouse model for chorea-acanthocytosis. |
Journal | |
Volume | |
Page | |
Year | |
PMID |
Disease name, Applicable field |