| CARD ID | 1852 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;CB-Ptf1atm1(EGFP)Card | |
| Internal Code | Ptf1a-EGFP knockin mouse | |
| Submitter | Ken-ichi YAMAMURA | |
| Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Institute of Resource Development and Analysis, Kumamoto University |
| Organization code | Card | |
| Developer | Ken-ichi Yamamura | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ptf1a |
| Gene name | pancreas specific transcription factor 1a |
| Allele symbol | Ptf1atm1(EGFP)Card |
| Allele name | pancreas specific transcription factor, 1a; targeted mutation 1, Center for Animal Resources and Development |
| MGI | MGI:1328312, |
| Chromosome | 2 (13.37) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Ptf1a-ex1-s1 | agc tcc agc aag cgg gta cta t |
| SP-A | cagtgtatatcattgtaacc |
| Disease name, Applicable field | Laboratory-animal Science, Diabetes, Endocrine Disorders, Metabolism |