| CARD ID | 1047 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6.129-Cirbptm1 | |
| Internal Code | CIRP KO | |
| Submitter | Teranishi Yutaka | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Dep of Clin Mol Biol, Faculty of Med, Kyoto University |
| Organization code | ||
| Developer | Jun Fujita | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Cirbp |
| Gene name | cold inducible RNA binding protein |
| Allele symbol | Cirbptm1 |
| Allele name | cold inducible RNA binding protein, targeted mutation 1 |
| MGI | MGI:893588, |
| Chromosome | 10 (44.0) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| OP4170 | 5'gcccagaaagcgaaggagcaaag3' |
| OP4240 | 5'gcttcgtgaagccaaagaaactgcgtaca3' |
| Disease name, Applicable field | Unknown |