CARD ID | 439 | |
Type of strain | Gene trap. | |
Strain name | B6;CB-Kcnk5Gt(pU-21)81Imeg | |
Internal Code | Ayu21-81 | |
Submitter | Ken-ichi YAMAMURA | |
Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Others
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Institute of Molecular Embryology and Genetics Kumamoto University |
Organization code | Imeg | |
Developer | Kimi Araki | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Kcnk5 |
Gene name | potassium channel, subfamily K, member 5 |
Allele symbol | Kcnk5Gt(Ayu21)81Imeg |
Allele name | targeted mutation 81, Institute of molecular embryology and genetics |
MGI | MGI:1336175, |
Chromosome | 14 , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
GO | Gene Ontology |
OMIM | OMIM ID: 603493 Human Gene Symbol: KCNK5, |
Z-1 | GCGTTACCCAACTTAATCG |
Z-2 | TGTGAGCGAGTAACAACCCG |
Author | |
Title | |
Journal | |
Volume | |
Page | |
Year | |
PMID |
Disease name, Applicable field | Development |
EGTC番号 | 21-81 |