CARD ID | 3265 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Gt(ROSA)26Sortm2(CAG-Evi1) | |
Internal Code | ROSA-CAG-Evi1 | |
Submitter | Tomomasa Yokomizo | |
Submitter affiliation or code | Tokyo Women’s Medical University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Gt(ROSA)26Sor |
Gene name | gene trap ROSA 26, Philippe Soriano |
Allele symbol | Gt(ROSA)26Sortm2(CAG-Evi1) |
Allele name | |
MGI | MGI:, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Evi1seq1152_Fw | ctgaggagagggaatacaagtgtg |
Evi1seq1413_Rv | acactgctgtggatgtgcttg |
Disease name, Applicable field | peromelia, cancer, Immunology, Development |