CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2774
Type of strain Transgenic.
Strain name C57BL/6-Tg(eR1(+24m)iCas9/tdTomato)10
Internal Code Tg(eR1(+24m)iCas9/tdTomato)B6-10Me
Submitter Oike Yuich
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Department of Molecular Biology, University of Occupational and Environmental Health, Japan
Organization code
Developer Motoyoshi Endo
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol RUNX1
Gene name eR1(Runx1 enhancer)
Allele symbol
Allele name
MGI MGI:,
Chromosome
Gene classification Gene to express(transgenic)
Method MicroInjection
OMIM
Gene symbol CASP9
Gene name iCaspase-9
Allele symbol
Allele name
MGI
Chromosome
Gene classification Gene to express(transgenic)
Method MicroInjection
OMIM
Gene symbol tdTomato
Gene name tdTomato
Allele symbol
Allele name
MGI
Chromosome
Gene classification Gene to express(transgenic)
Method MicroInjection
OMIM

PCR Primer 1
mCNE20-325FP CACTGATAACGTGGGCAGCTT
mhsp68-175RP GTGTCCGGTGACGTGATCCTC


Disease , Applicable field information

Disease name, Applicable field Development, Molecular biology, Respiratory System, cancer


EGTC

EGTC番号




Copyright @ 2021 Kumamoto University. All rights reserved.