CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2692
Type of strain Targeted mutant.
Strain name C57BL/6N-Upp1tm3Mtb;Tymptm3Mtb
Internal Code C57BL/6N-TPtm3Mtb/TPtm3Mtb:UPtm3Mtb/UPtm3Mtb
Submitter Masatatsu Yamamoto
Submitter affiliation or code
Stock Type
Material Transfer Conditions Consent to us
Production method
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Upp1
Gene name uridine phosphorylase 1
Allele symbol Upp1tm3Mtb
Allele name uridine phosphorylase 1, targeted mutation 3,
MGI MGI:1097668,
Chromosome 11 (6.13) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM
Gene symbol Tymp
Gene name thymidine phosphorylase
Allele symbol Tymptm3Mtb
Allele name thymidine phosphorylase, targeted mutation 3,
MGI MGI:1920212,
Chromosome 15 (44.86) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Tpf GAGCGCTGTAACCCGACCCT
Tpr TATCACCGCGTGCACGAAGTTTC
PCR Primer 2
Tpf GAGCGCTGTAACCCGACCCT
Neo CCGATTCGCAGCGCATCGCC
PCR Primer 3
UPG2 CAAAGCTGAGGCCCAACTGCCATGG
UPG3 CCTTGGACTTCCATTCACAGCTGCG
PCR Primer 4
PGK3 CCTGAAGAACGAGATCAGCAGCCTC
UPG4 AGCTCTTGCTCCTTCGCCTGCTTGC


References

Author Misako Haraguchi, Hiroaki Tsujimoto, Masakazu Fukushima, Itsuro Higuchi, Hideto Kuribayashi, Hideo Utsumi, Atsuo Nakayama, Yoshio Hashizume, Junko Hirato, Hiroki Yoshida, Hiromitsu Hara, Shinjiro Hamano, Hiroaki Kawaguchi, Tatsuhiko Furukawa, Kohei Miyazono, Fuyuki Ishikawa, Hideo Toyoshima, Tadashi Kaname, Masaharu Komatsu, Zhe-Sheng Chen, Takenari Gotanda, Tokushi Tachiwada1, Tomoyuki Sumizawa, Kazutaka Miyadera, Mitsuhiro Osame, Hiroki Yoshida, Tetsuo Noda, Yuji Yamada and Shin-ichi Akiyama
Title Targeted Deletion of Both Thymidine Phosphorylase and Uridine Phosphorylase and Consequent Disorders in Mice
Journal
Volume
Page
Year
PMID


Disease , Applicable field information

Disease name, Applicable field cancer






Copyright @ 2021 Kumamoto University. All rights reserved.