CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 249
Type of strain Transgenic.
Strain name B6;BALB-Tg(0.6hTTRMet30)14Imeg
Internal Code ,
Submitter Ken-ichi YAMAMURA
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Institute for Molecular Embryology and Genetics
Organization code IMEG
Developer Ken-ichi Yamamura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Ttr
Gene name transthyretin Val 30 Met (Human)
Allele symbol
Allele name
MGI MGI:98865,
Chromosome Unknown ,
Gene classification Gene to express(transgenic)
Method
GO Gene Ontology
OMIM OMIM ID: 176300 Human Gene Symbol: TTR,

PCR Primer 1
primerA 5'(TCTCACGTGTCTTCTCTACA)3'
primerB 3'(AGCCTCTCTCTACCAAGTGA)5'


References

Author Hiromitsu Noguchi, Tadashi Kaname, Tomohisa Sekimoto, Kei Senba, Yasushi Nagata, Masatake Araki, Makoto Abe, Naomi Nakagata, Tomomichi Ono, Ken-ichi Yamamura and Kimi Araki
Title Naso-maxillary deformity due to frontonasal expression of human transthyretin gene in transgenic mice
Journal Genes to Cells
Volume 7
Page 1087-1098
Year 2002
PMID 12354101


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.