CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 244
Type of strain Transgenic.
Strain name C57BL/6-Tg(0.6hTTRMet30)14Imeg
Internal Code ,
Submitter Ken-ichi YAMAMURA
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Institute of Molecular Embryology and Genetics, Kumamoto Univ.
Organization code IMEG
Developer Ken-ichi Yamamura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Ttr
Gene name Transthyretin Val30Met(Human)
Allele symbol
Allele name
MGI MGI:98865,
Chromosome 13 ,
Gene classification Gene to express(transgenic)
Method
GO Gene Ontology
OMIM OMIM ID: 176300 Human Gene Symbol: TTR,

PCR Primer 1
primerA 5'(TCTCACGTGTCTTCTCTACA)3'
primerB 3'(AGCCTCTCTCTACCAAGTGA)5'


References

Author Ken-ichi Yamamura, Shoji Wakasugi, Shuichiro Maeda, Takeaki Inomoto, Tomohisa Iwanaga, Masahiro Uehira, Kimi Araki, Jun-ichi Miyazaki, and Kazunori Shimada
Title Tissue-Specific and Developmental Expression of Human Transthyretin Gene in Transgenic Mice
Journal Developmental Genetics
Volume 8
Page 195-205
Year 1987
PMID 3502973
Author Shoji Wakasugi, Tomohisa Iwanaga, Takeaki Inomoto, Toshimoto Tengan, Shuichiro Maeda, Masahiro Uehira, Kimi Araki, Junichi Miyazaki, Kazuhiro Eto, Kazunori Shimada, and Ken-ichi Yamamura
Title An Autosomal Dominant Mutation of Facial Development in a Transgenic Mouse
Journal Developmental Genetics
Volume 9
Page 203-212
Year 1988
PMID 3409558
Author Hiromitsu Noguchi, Tadashi Kaname, Tomohisa Sekimoto, Kei Senba, Yasushi Nagata, Masatake Araki, Makoto Abe, Naomi Nakagata, Tomomichi Ono, Ken-ichi Yamamura and Kimi Araki
Title Naso-maxillary deformity due to frontonasal expression of human transthyretin gene in transgenic mice
Journal Genes to Cells
Volume 7
Page 1087-1098
Year 2002
PMID 12354101


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.