CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2397
Type of strain Targeted mutant.
Strain name B6D2F1-Tardbpem1
Internal Code B6D2F1-TDP43del
Submitter Shibuya Toshiharu
Submitter affiliation or code Osaka University
Stock Type
Material Transfer Conditions No condition
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced 2014 / 10
Introduced Generation
Remarks


Gene information

Gene symbol Tardbp
Gene name TAR DNA binding protein
Allele symbol Tardbpem1
Allele name TAR DNA binding protein, endonuclease-mediated mutation 1,
MGI MGI:2387629,
Chromosome 4 (78.77) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM

PCR Primer 1
Tardbp-BamF AAAGGATCCTTAGGCAAACAGCAGTTCACTTTCAC
Tardbp-EcoR AAAGAATTCTTAACATTACTATAACTAAAGGCTGCTGG


Disease , Applicable field information

Disease name, Applicable field Unknown






Copyright @ 2021 Kumamoto University. All rights reserved.