CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2378
Type of strain Targeted mutant.
Strain name B6;129-Triml1tm1Miya
Internal Code Triml1 KO
Submitter Miyazaki Jun-ichi
Submitter affiliation or code Division of Stem Cell Regulation Research,Osaka University Graduate School of Medicine
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code Miya
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Triml1
Gene name tripartite motif family-like 1
Allele symbol Triml1tm1Miya
Allele name tripartite motif family-like 1, targeted mutation 1,
MGI MGI:2687279,
Chromosome 8 (23.89) (8A4) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Cue320-seq3-F AGTGTCAATTCATTGTGCGTC
Cue320-WT-allele-R TCTACCCTGAGCATCTGAGAGACTC


Disease , Applicable field information

Disease name, Applicable field Development, Reproduction






Copyright @ 2021 Kumamoto University. All rights reserved.