CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2240
Type of strain Transgenic.
Strain name STOCK-Tg(CM-tslc1-IRES-hrGFP)a
Internal Code TgN(CM-tslc1-IRES-hrGFP)-a
Submitter Wakayama Tomohiko
Submitter affiliation or code Kumamoto University
Stock Type
Material Transfer Conditions No condition
Production method in-house breeding
Origin (In-house) Organization Kumamoto University
Organization code
Developer Tomohiko Wakayama
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol tsk1
Gene name tumor suppressor in lung cancer -1
Allele symbol
Allele name
MGI
Chromosome
Gene classification Gene to express(transgenic)
Method MicroInjection
OMIM

PCR Primer 1
hrGFP-F TTCACCAAGTACCCCGAG
hrGFP-R CATGTGGCAGCTGTAGAACT


References

Author Satouh Y, Nozawa K, Ikawa M.
Title Sperm postacrosomal WW domain-binding protein is not required for mouse egg activation
Journal Biol Reprod
Volume 93(4)
Page 94
Year 2015
PMID


Disease , Applicable field information

Disease name, Applicable field Anatomy, Development






Copyright @ 2021 Kumamoto University. All rights reserved.