CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2144
Type of strain Targeted mutant.
Strain name C57BL/6-Tepptm1a(KOMP)Osb/88
Internal Code Tepp KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Tepp
Gene name testis, prostate and placenta expressed
Allele symbol Tepptm1a(KOMP)Osb
Allele name testis, prostate and placenta expressed, targeted mutation 1a,Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
MGI MGI:1920657,
Chromosome 8 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
#5083 actgatggcgagctcagacc
#5381 tcaactatctgactccctgg
PCR Primer 2
#5862 gagtatcttggagtccccatctcaccc
#5863 ggatcttggttaggggttgcaagcg


References

Author H. Miyata, J.M. Castaneda, Y. Fujihara, Z. Yu, D.R. Archambeault, A. Isotani, D. Kiyozumi, M.L. Kriseman, D. Mashiko, T. Matsumura, R.M. Matzuk, M. Mori, T. Noda, A. Oji, M. Okabe, R. Prunskaite-Hyyrylainen, R. Ramirez-Solis, Y. Satouh, Q. Zhang, M. Ikawa, M.M. Matzuk
Title Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice
Journal Proc. Natl. Acad. Sci.
Volume 113
Page 7704-7710
Year 2016
PMID


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.