CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 1850
Type of strain Targeted mutant.
Strain name C57BL/6-Tarm1tm1Yiw
Internal Code Tarm1 KO
Submitter Iwakura Yoichiro
Submitter affiliation or code Division of Laboratory Animal,Research Institute for Biological Sciences, Tokyo University of Science
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Institute of Medical Science, University of Tokyo
Organization code
Developer Yoichiro Iwakura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Tarm1
Gene name T cell-interacting, activating receptor on myeloid cells 1
Allele symbol
Allele name T cell-interacting, activating receptor on myeloid cells 1, Yoichiro Iwakura, University of Tokyo
MGI
Chromosome 7 (2.04) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Tarm1 common F1 TAAACCCAGCAAGCCCAGTGTTAGG
WT_genotyping_R1 GGAGGCAGAGAAGGGAAAGGAGC
PCR Primer 2
Tarm1 common F1 TAAACCCAGCAAGCCCAGTGTTAGG
EGFP-R1 CTGAACTTGTGGCCGTTTACGTCG


Disease , Applicable field information

Disease name, Applicable field Unknown






Copyright @ 2021 Kumamoto University. All rights reserved.