CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 1824
Type of strain Transgenic.
Strain name B6;D2-Tg(CAG/CAT-tvA)P2Tama
Internal Code B6;D2-Tg(CAG/CAT/tvA)P2
Submitter Esumi Shigeyuki
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Need acknowledgement in publishing paper.
Production method From other organizations
Origin (In-house) Organization Deparatment of Morphological Neural Science, Graduate School of Medicine, Kumamoto University
Organization code Tama
Developer Nobuaki Tamamaki
Origin (From other organizations) Organization Kyoto Univ.
Organization code
Developer Nobuaki tamamaki
Year introduced 2004 / 6
Introduced Generation
Remarks Need contact to Nobuaki Tamamaki ( tamamaki@kumamoto-u.ac.jp ). Need acknowledgement in publication.


Gene information

Gene symbol tvA
Gene name tv-A800
Allele symbol Tg(CAG/CAT-tvA)P2Tama
Allele name transgene insertion P2, Nobuaki Tamamaki
MGI
Chromosome Unknown ,
Gene classification Gene to express(transgenic)
Method MicroInjection
OMIM

PCR Primer 1
tvaup ATGGCGCGGCTGCTGCCCGCGCT
tvalow TTATCAGTCCCATCTCACCAGCT


References

Author Shengxi Wu, Shigeyuki Esumi, Keisuke Watanabe, Jing Chen, Kouichi C. Nakamura, Kazuhiro Nakamura, Kouhei Kometani, Nagahiro Minato, Yuchio Yanagawa, Kaori Akashi, Kenji Sakimura, Takeshi Kaneko and Nobuaki Tamamaki
Title Tangential migration and proliferation of intermediate progenitors of GABAergic neurons in the mouse telencephalon
Journal Development
Volume 138
Page 2499-2509
Year 2011
PMID


Disease , Applicable field information

Disease name, Applicable field Molecular biology, Development, Laboratory-animal Science, Cell biology, Neurobiology






Copyright @ 2021 Kumamoto University. All rights reserved.