CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 1227
Type of strain Gene trap.
Strain name B6;CB-Tspan9Gt(pU-21W)166Card
Internal Code Ayu21-W166
Submitter Ken-ichi YAMAMURA
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization IRDA, kumamoto University
Organization code
Developer Kimi Araki
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Tspan9
Gene name tetraspanin 9
Allele symbol
Allele name
MGI MGI:1924558,
Chromosome 6 (chr6:127,910,000-128,100,000) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
GO Gene Ontology
OMIM

PCR Primer 1
Z-1 GCGTTACCCAACTTAATCG
Z-2 TGTGAGCGAGTAACAACCCG


Disease , Applicable field information

Disease name, Applicable field Development


EGTC

EGTC番号 21-W166




Copyright @ 2021 Kumamoto University. All rights reserved.