CARD R-BASE



Mouse strain


Strain information

CARD ID 3375
Type of strain Targeted mutant.
Strain name C3H.Cg-Grntm1
Internal Code Grn KO マウス
Submitter Katsuhide Okunishi
Submitter affiliation or code Institute for Molecular and Cellular Regulation, Gunma University
Stock Type
Material Transfer Conditions Consent to us
1. Prior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITORs using the Approval Form.
2. The availability of the BIOLOGICAL RESOURCE is limited to a RECIPIENT of a not-for profit institution for a not-for-profit research.
3. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITORs is requested.
4. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITORs is requested.
5. The RECIPIENT must contact the DEPOSITORs in the case of application for any patents or commercial use based on the results from the use of the BIOLOGICAL RESOURCE.
Production method in-house breeding
Origin (In-house) Organization Institute for Molecular and Cellular Regulation
Organization code
Developer Hiroshi Gomi, Tetsuro Izumi
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Gun
Gene name granulin
Allele symbol Grntm1
Allele name granulin; targeted mutation 1,
MGI MGI:95832,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
Grn/Fow1 ACAGGCAGCGAGATAATCAG
Grn/Rev1Primer2 TGAATGATCCTTCTTCCTGG
Neo/Fow2 CTTGACGAGTTCTTCTGAGG


References

Author Hiroshi Gomi, Shin Mizutani, Kazuo Kasai, Shigeyoshi Itohara, Tetsuro Izumi
Title Granuphilin molecularly docks insulin granules to the fusion machinery
Journal J Cell Biol
Volume 171
Page 99-109
Year 2005
PMID 16216924


Disease , Applicable field information

Disease name, Applicable field Metabolism, Endocrine Disorders, Neurobiology, Diabetes, Cell biology, Molecular biology






Copyright @ 2021 Kumamoto University. All rights reserved.