CARD ID | 2596 | |
Type of strain | Targeted mutant. | |
Strain name | B6D2;B6-Izumo1rem1Osb | |
Internal Code | Izumo1r (Juno) KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Others
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Izumo1r |
Gene name | IZUMO1 receptor, JUNO |
Allele symbol | Izumo1rem1Osb |
Allele name | IZUMO1 receptor, JUNO, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:1929185, |
Chromosome | 9 (4.42) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
CCCCTGTTGGTCAGTTTGCTTTCTACATTC | |
GGAATGTTCCTCCTCCCACAGCC |
Author | Kazuki Kato, Yuhkoh Satouh, Hiroshi Nishimasu, Arisa Kurabayashi, Junko Morita, Yoshitaka Fujihara, Asami Oji, Ryuichiro Ishitani, Masahito Ikawa & Osamu Nureki |
Title | Structural and functional insights into IZUMO1 recognition by JUNO in mammalian fertilization |
Journal | Nature Communications |
Volume | 15 |
Page | 12198 |
Year | 2016 |
PMID |
Disease name, Applicable field |