CARD ID | 2659 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Creb3l1tm1 | |
Internal Code | Oasis-f | |
Submitter | Araki Kimi | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Creb3l1 |
Gene name | cAMP responsive element binding protein 3-like 1 |
Allele symbol | Creb3l1tm1 |
Allele name | cAMP responsive element binding protein 3-like 1; targeted mutation 1, |
MGI | MGI:1347062, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
neo-F | aga ggc tat tcg gct atg ac |
Oasis-3arm-r1 | TTTGAGTGCTCTGCTGCATCTA |
Disease name, Applicable field | Endocrine Disorders |