CARD ID | 2979 | |
Type of strain | Targeted mutant. | |
Strain name | B6D2-Zfand3em2Osb | |
Internal Code | B6D2-Zfand3em2Osb | |
Submitter | takehara tetsuo | |
Submitter affiliation or code | Osaka University.Graduate School of Medicine.Department of Gastroenterology and Hepatology | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
|
Production method | ||
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Zfand3 |
Gene name | zinc finger, AN1-type domain 3 |
Allele symbol | Zfand3em2Osb |
Allele name | zinc finger, AN1-type domain 3; endonuclease-mediated mutation 2, |
MGI | MGI:1096572, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Fw3 | GGATGAGAGGGTATGCTGGG |
Rv3 | TTCCAGGCTCCCTAACATGG |
Disease name, Applicable field |