CARD ID | 2327 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6-Tg(eR1(+24m)-mhsp68-CreERT2)5-2 | |
Internal Code | eR1(+24m)CreERT2#5-2 | |
Submitter | Osato Motomi | |
Submitter affiliation or code | International Research Center for Medical Sciences, Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | International Research Center for Medical Sciences, Kumamoto University AND Cancer Science Institute of Singapore, National University of Singapore |
Organization code | ||
Developer | Motomi Osato | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | CreERT2 |
Gene name | Cre recombinase T2 |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | Unknown , |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
eR1(+24m)-325FP | CACTGATAACGTGGGCAGCTT |
mhsp68-175RP | GTGTCCGGTGACGTGATCCTC |
Author | Ng CE, Yokomizo T, Yamashita N, Cirovic B, Jin H, Wen Z, Ito Y, Osato M. |
Title | A Runx1 intronic enhancer marks hemogenic endothelial cells and hematopoietic stem cells. |
Journal | Stem Cells |
Volume | 28(10) |
Page | 1869-81 |
Year | 2010 |
PMID |
Disease name, Applicable field | Respiratory System, Aging, Development, Laboratory-animal Science, cancer, Urology, Digestive Disorders |