CARD ID | 2642 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Meikintm1 | |
Internal Code | Meikin Ex6 (+/-) | |
Submitter | Ishiguro Kei-ichiro | |
Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Kei-ichiro Ishiguro |
Organization code | ||
Developer | Institute of Molecular Embryology and Genetics, Kumamoto University | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Meikin |
Gene name | meiotic kinetochore factor |
Allele symbol | Meikintm1 |
Allele name | meiotic kinetochore factor; targeted mutation 1, |
MGI | MGI:1922097, |
Chromosome | 11 (32.13) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
Ex3F (common-forward) | CCCCAGAGGAAAAGACACCACC |
Ex4R (wild-type-reverse) | CTCGACAACAAGCTGTCCATCTC |
Ex3F (common-forward) | CCCCAGAGGAAAAGACACCACC |
Neo4R (mutant-reverse) | CATGAGTGGGAGGAATGAGCTGGC |
Author | Kim J, Ishiguro K., Nambu A., Akiyoshi B., Yokobayashi S., Kagami A., Ishiguro T., Pendas A.M., Takeda N., Sakakibara Y., Kitajima T.S., Tanno Y., Sakuno T., Watanabe Y. |
Title | Meikin is a conserved regulator of meiosis-I-specific kinetochore function |
Journal | Nature |
Volume | 517 |
Page | 466-471 |
Year | 2015 |
PMID |
Disease name, Applicable field | Molecular biology, Development, Cell biology, Reproduction |