CARD ID | 1301 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6-Tg(T1r3-WGA)273M2Abek | |
Internal Code | Tg(T1r3-WGA)273M2Abek | |
Submitter | - - | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Graduate Shool of Agricultural and Life Sciences, The University of Tokyo |
Organization code | 不明 | |
Developer | Keiko Abe | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | WGA |
Gene name | wheat germ agglutinin |
Allele symbol | Tg(T1r3-WGA)273M2Abek |
Allele name | transgene insertion 273M2, Keiko Abe |
MGI | |
Chromosome | Unknown , |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
T1R3-F1 | AGCAGAACAGCTGAGACCCTTGC |
WGA-R1 | CGTAAGGGCCATGGTGCTCATCATCTTTCT |
Author | Makoto Ohmoto , Ichiro Matsumoto , Akihito Yasuoka , Yoshihiro Yoshihara , Keiko Abe |
Title | Genetic tracing of the gustatory and trigeminal neural pathways originating from T1R3-expressing taste receptor cells and solitary chemoreceptor cells |
Journal | Molecular and Cellular Neuroscience |
Volume | 38 |
Page | 505–517 |
Year | 2008 |
PMID |
Disease name, Applicable field | Physiology, Anatomy, Neurobiology |