| CARD ID | 2615 | |
| Type of strain | Transgenic. | |
| Strain name | B6D2-Tg(Clgn-Ppp3cc-mCherry)Osb | |
| Internal Code | Ppp3cc-mCherry Tg | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ppp3cc, mCherry |
| Gene name | Ppp3cc, mCherry |
| Allele symbol | Tg(Clgn-Ppp3cc-mCherry)Osb |
| Allele name | transgene insertion, Research Institute for Microbial Diseases, Osaka University |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | |
| OMIM |
| Ppp3ccmCherryFw | GAATTCATGTCCGTGAGGCGCCCTCAGTTC |
| Ppp3ccmCherryRv | CCCCTCGAGTTACAGGGCTTTCTTTCCATG |
| Author | Miyata H, Satouh Y, Mashiko D, Muto M, Nozawa K, Shiba K, Fujihara Y, Isotani A, Inaba K, Ikawa M. |
| Title | Sperm calcineurin inhibition prevents mouse fertility with implications for male contraceptive. |
| Journal | Science |
| Volume | 350(6259) |
| Page | 442-5 |
| Year | 2015 |
| PMID |
| Disease name, Applicable field |