CARD R-BASE



Mouse strain


Strain information

CARD ID 2181
Type of strain Targeted mutant.
Strain name C57BL/6N-Tex22tm1a(EUCOMM)Osb/48
Internal Code Tex22 KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Tex22
Gene name testis expressed gene 22
Allele symbol Tex22tm1a(EUCOMM)Osb
Allele name testis expressed gene 22, targeted mutation 1a, Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
MGI MGI:1922921,
Chromosome 12 (61.57) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
#5083 ACTGATGGCGAGCTCAGACC
#5509 CTGCTCAGCCCAGTATTATATTGTCCAGTG
PCR Primer 2
#6055 GGCCGAGCTGATGTCTGAGGG
#6056 GGCTGATAAAGCAGCGGGCC


References

Author Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM.
Title Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice.
Journal Proc Natl Acad Sci U S A.
Volume 113(28)
Page 7704-10
Year 2016
PMID 27357688


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.