CARD ID | 3165 | |
Type of strain | Gene trap. | |
Strain name | B6;Cg-Trp53cor1Gt(Ayu21-B186*SALacZΔCpGnlsΔPGKPuro)1Card | |
Internal Code | Trp53cor1-SALacZΔCpGΔ(PGKPuro) | |
Submitter | Araki Kimi | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Division of Developmental Genetics, Institute of Resource Development and Analysis, Kumamoto University |
Organization code | CARD | |
Developer | Kimi Araki | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Trp53cor1 |
Gene name | tumor protein p53 pathway corepressor 1 |
Allele symbol | |
Allele name | |
MGI | MGI:3801771, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
B186-G2 | CCGAGCTGTCTATTCCTCAG |
B186-G4 | CAGCTCCCACCAATGGAATG |
SA-5'AS | GGGCAAGAACATAAAGTGACC |
Author | Riki Furuhata, Mai Imasaka, Michihiko Sugimoto, Kumiko Yoshinobu, Masatake Araki, Kimi Araki |
Title | LincRNA-p21 exon1 expression correlates with Cdkn1a expression in vivo |
Journal | Genes Cells |
Volume | 27 |
Page | 14-24 |
Year | 2021 |
PMID | 34808017 |
Disease name, Applicable field | Cell biology, Development, Molecular biology |