CARD ID | 2241 | |
Type of strain | Transgenic. | |
Strain name | STOCK-Tg(CM-tslc1-IRES-hrGFP)b | |
Internal Code | TgN(CM-tslc1-IRES-hrGFP)-b | |
Submitter | Wakayama Tomohiko | |
Submitter affiliation or code | Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
No condition
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Kumamoto University |
Organization code | ||
Developer | Tomohiko Wakayama | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | tsk1 |
Gene name | tumor suppressor in lung cancer -1 |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
hrGFP-F | TTCACCAAGTACCCCGAG |
hrGFP-R | CATGTGGCAGCTGTAGAACT |
Author | Fujihara Y, Okabe M, Ikawa M |
Title | GPI-anchored protein complex, LY6K/TEX101, is required for sperm migration into the oviduct and male fertility in mice. |
Journal | Biol Reprod |
Volume | 90(3) |
Page | 60 |
Year | 2014 |
PMID |
Disease name, Applicable field | Anatomy, Development |