CARD ID | 1153 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK Calrtm1.1Osb | |
Internal Code | calr-tm1 | |
Submitter | Masaru Okabe | |
Submitter affiliation or code | Genome Information Research (enter Osaka University) | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
The RECIPIENT must contact the person listed below in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES. mta-egr@biken.osaka-u.ac.jp (Contact to Masahito Ikawa) |
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | Research Institute for Microbial Diseases, Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Calr |
Gene name | calreticulin |
Allele symbol | Calrtm1.1Osb |
Allele name | calreticulin, targeted mutation 1.1, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:88252, |
Chromosome | 8 (41.21) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
2621 | gagtggaaaccaggtgaaattgacaacc |
2622 | cttctctgataagttttcctctgacctc |
Author | Tokuhiro K1, Satouh Y1, Nozawa K1,2, Isotani A1,3,4, Fujihara Y1, Hirashima Y5, Matsumura H1,4, Takumi K1,4, Miyano T5, Okabe M1, Benham AM1,6, Ikawa M1,2,3,4. |
Title | Calreticulin is required for development of the cumulus oocyte complex and female fertility. |
Journal | Sci Rep. |
Volume | 5 |
Page | 14254 |
Year | 2015 |
PMID |
Disease name, Applicable field | Physiology, Development, Immunology, Metabolism |