| CARD ID | 2232 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Six1em2(EGFPdelta25)Six4em2(LacZ delta44) | |
| Internal Code | Six1/Six4 Talen20 | |
| Submitter | KAWAKAMI KIYOSHI | |
| Submitter affiliation or code | jichi medical university | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Jichi medical university |
| Organization code | ||
| Developer | Kiyoshi Kawakami | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Six4 |
| Gene name | sine oculis-related homeobox 4 |
| Allele symbol | Six4em2 |
| Allele name | sine oculis-related homeobox 4, endonuclease-induced mutation 2 |
| MGI | MGI:106034, |
| Chromosome | 12 (30.36) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Other |
| OMIM |
| Gene symbol | Six1 |
| Gene name | sine oculis-related homeobox 1 |
| Allele symbol | Six1em2 |
| Allele name | sine oculis-related homeobox 1, endonuclease-induced mutation 2 |
| MGI | MGI:102780, |
| Chromosome | 12 (30.34) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Other |
| OMIM |
| LacZTALEN#20-F | AACAGTTGCGCAGCGCGGTGCCGG |
| LacZTALEN-R | TCCTGATCTTCCAGATAACTGCCG |
| Author | Takahashi M, Ikeda K, Ohmuraya M, Nakagawa Y, Sakuma T, Yamamoto T, Kawakami K. |
| Title | Six1 is required for signaling center formation and labial-lingual asymmetry in developing lower incisors. |
| Journal | Developmental Dynamics |
| Volume | doi: 10. |
| Page | 1002/dvdy.174. |
| Year | 2020 Apr 3. |
| PMID |
| Disease name, Applicable field | Development, Neurobiology |