| CARD ID | 2974 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6J-Pdpnem1Osb | |
| Internal Code | Pdpn KO | |
| Submitter | Yamasaki Sho | |
| Submitter affiliation or code | Department of Molecular Immunology, Research Institute for Microbial Diseases, Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Pdpn |
| Gene name | Podoplanin |
| Allele symbol | Pdpnem1Osb |
| Allele name | podoplanin; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:103098, |
| Chromosome | 4 (77.29) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| pdpn forward primer | GCCTGTGGCTTCGAAGTTTTT |
| pdpn reverse primer | AACAAGTGCTGGTTGCCAATCAT |
| Disease name, Applicable field | Development |