| CARD ID | 2891 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Ehbp1l1tm1 | |
| Internal Code | Ehbp1l1 tm1-B6 | |
| Submitter | - - | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Osaka University |
| Organization code | ||
| Developer | Akihiro Harada | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ehbp1l1 |
| Gene name | EH domain binding protein 1-like 1 |
| Allele symbol | Ehbp1l1tm1 |
| Allele name | EH domain binding protein 1-like 1, targeted mutation 1, |
| MGI | MGI:3612340, |
| Chromosome | 19 (4.34) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| EHBP1L1-F | GACAAAGAAAAGAGCTCCAGAGACC |
| EHBP1L1-R | CCTTGACAGTCCAATACAAGACCTG |
| Disease name, Applicable field | Unknown |