CARD R-BASE



Mouse strain


Strain information

CARD ID 2123
Type of strain Targeted mutant.
Strain name C57BL/6N- Ero1a tm1a(KOMP)Osb
Internal Code B6-Ero1l floxed
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Using the BIOLOGICAL RESOURCE is limited to the academic research of academic institutions.
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it as well as consent for collaborative research from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.The RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial use based on the results from the use of the BIOLOGICAL RESOURCE. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR and a mention of the Knockout Mouse Project and the KOMP Repository as the source of the original allele and mice are requested.
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code -
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Ero1a
Gene name endoplasmic reticulum oxidoreductase 1 alpha
Allele symbol Ero1a tm1a(KOMP)Osb
Allele name endoplasmic reticulum oxidoreductase 1 alpha; targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University
MGI MGI:1354385,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
5084 ACCCAGAAAGCTGTACTTCA
5083 ACTGATGGCGAGCTCAGACC
PCR Primer 2
5318 CACACCTCCCCCTGAACCTGAAAC
5083 ACTGATGGCGAGCTCAGACC


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.