CARD ID | 2845 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK-Ehbp1l1tm1 | |
Internal Code | Ehbp1l1 tm1 | |
Submitter | - - | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Osaka University |
Organization code | ||
Developer | Akihiro Harada | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Ehbp1l1 |
Gene name | EH domain binding protein 1-like 1 |
Allele symbol | Ehbp1l1tm1 |
Allele name | EH domain binding protein 1-like 1, targeted mutation 1, |
MGI | MGI:3612340, |
Chromosome | 19 (4.34) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
EHBP1L1-F | GACAAAGAAAAGAGCTCCAGAGACC |
EHBP1L1-R | CCTTGACAGTCCAATACAAGACCTG |
Disease name, Applicable field | Unknown |