CARD ID | 502 | |
Type of strain | Targeted mutant. | |
Strain name | B6;129-Sall4tm6 | |
Internal Code | N-Sall4 #104 | |
Submitter | Nishinakamura Ryuichi | |
Submitter affiliation or code | Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Univ. of Tokyo. Inst. of Med. Sci. Div. of Stem cell regulation |
Organization code | ||
Developer | Masayo Yumoto | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Sall4 |
Gene name | sal-like4 (Drosophila) |
Allele symbol | |
Allele name | |
MGI | MGI:2139360, |
Chromosome | 2 (99.0) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
N-Sall4 genome check (N-Sall4 F, N-Sall4 R, N-Sall4 X CAG-cre R); mixture of 25 micro M each | CCTTCACCTTGAAGCCTGAC, GGGACAGGGAGTGCATAGTG, CAGCCTGGTCTACAGTGCAA |
|
Disease name, Applicable field | Development |