CARD R-BASE



Mouse strain


Strain information

CARD ID 3081
Type of strain Targeted mutant.
Strain name C57BL/6-Gt(ROSA)26Sorem1(Stra8-Meiosin)/31
Internal Code Rosa26-frox Kusabira-Stra8-p2A-Meiosin- Line #31
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Collaboration permission is required for usage of this line
Production method in-house breeding
Origin (In-house) Organization Department of Chromosome Biology Institute of Molecular Embryology and Genetics, Kumamoto University
Organization code
Developer Kei-ichiro Ishiguro
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Rosa26
Gene name Rosa26
Allele symbol Stra8tm1(GFP)
Allele name Stimulated by retinoids acid 8, targeted mutation 1,
MGI MGI:107917,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
S8-1F GTGCCTGGAGACCTTTGACGATCTG
Gm-1R gcttgagcaaggccttggtcatgtc


References

Author Ishiguro K, Matsuura K, Tani N, Takeda N, Usuki S, Yamane M, Sugimoto M, Fujimura S, Hosokawa M, Chuma S, Ko S.H.M, Araki K, Niwa H.
Title MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells.
Journal Dev. Cell
Volume 52(4)
Page 429-445
Year 2020
PMID


Disease , Applicable field information

Disease name, Applicable field Molecular biology






Copyright @ 2021 Kumamoto University. All rights reserved.