CARD ID | 2857 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Zfp541em4 | |
Internal Code | ZFP541-Line#16 | |
Submitter | Ishiguro Kei-ichiro | |
Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Zfp541 |
Gene name | zinc finger protein 541 |
Allele symbol | Zfp541em4 |
Allele name | zinc finger protein 541; endonuclease-mediated mutation 4, |
MGI | MGI:3647699, |
Chromosome | 7 (8.74) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
ZFP541-F1 | agctagctgccagcgagggctcttc |
ZFP541-R2 | tggttgagtgtgtcactgcagttgag |
ZFP541-R3 | gaggcagcagaagggaggtaggatg |
Disease name, Applicable field | Cell biology, Reproduction |