CARD ID | 2556 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Neurod6tm1(cre) | |
Internal Code | NEX(Neurod6)-cre | |
Submitter | Esumi Shigeyuki | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
If you use NEX(Neurod6)-Cre mouse, please contact to Prof. Klaus-Armin Nave in Max Planck Institute for MTA. |
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | Max Planck Institute for Experimental Medicine, Göttingen |
Organization code | ||
Developer | Prof. Klaus-Armin Nave Ph.D. | |
Year introduced | 2005 / 4 | |
Introduced Generation | 10 | |
Remarks |
Gene symbol | Neurod6 |
Gene name | neurogenic differentiation 6 |
Allele symbol | Neurod6tm1(cre) |
Allele name | neurogenic differentiation 6, targeted mutation 1, |
MGI | MGI:106593, |
Chromosome | 6 (27.53) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Cre F (e26) | tcgatgcaacgagtgatgag |
Cre R (e27) | ttcggctatacgtaacaggg |
Author | Sandra Goebbels, Ingo Bormuth, Ulli Bode, Ola Hermanson, Markus H. Schwab, Klaus-Armin Nave |
Title | Genetic targeting of principal neurons in neocortex and hippocampus of NEX-Cre mice |
Journal | GENESIS |
Volume | 44(12) |
Page | 611-21 |
Year | 2006 |
PMID |
Author | Wu SX, Goebbels S, Nakamura K, Nakamura K, Kometani K, Minato N, Kaneko T, Nave KA, Tamamaki N. |
Title | Pyramidal neurons of upper cortical layers generated by NEX-positive progenitor cells in the subventricular zone. |
Journal | Proc Natl Acad Sci U S A |
Volume | 102(47) |
Page | 17172-7 |
Year | 2005 |
PMID |
Disease name, Applicable field | Molecular biology, Cell biology, Neurobiology, Hematology, Ophthalomology |