CARD ID | 2213 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK-Svs2tm1Osb | |
Internal Code | SVS2KO handai | |
Submitter | Unknown Unknown | |
Submitter affiliation or code | ||
Stock Type | ||
Material Transfer Conditions |
Consent to us
Joint research |
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | Institute for microbial diseases, Osaka University |
Organization code | ||
Developer | Masaru Okabe | |
Year introduced | ||
Introduced Generation | F0 | |
Remarks |
Gene symbol | Svs2 |
Gene name | seminal vesicle secretory protein 2 |
Allele symbol | Svs2tm1Osb |
Allele name | seminal vesicle secretory protein 2, targeted mutation 1 |
MGI | MGI:1858275, |
Chromosome | 2 (84.82) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
GO | Gene Ontology |
OMIM | OMIM ID: 143030 Human Gene Symbol: CD9, |
2516 | 5'(caaacdtggggactaagcat)3' |
Neo | 5'(atctggacgaagagcatcag)3' |
Author | Natsuko Kawano, Naoya Araki, Kaoru Yoshida, Taku Hibino, Naoko Ohnami, Maako Makino, Seiya Kanai, Hidetoshi Hasuwa, Manabu Yoshida, Kenji Miyado, Akihiro Umezawa |
Title | Seminal vesicle protein SVS2 is required for sperm survival in the uterus |
Journal | Proceedings of the National Academy of Sciences |
Volume | 111 |
Page | 4145-4150 |
Year | 2014 |
PMID |
Disease name, Applicable field | Development |