| CARD ID | 1961 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6N-Tg(GPP34) | |
| Internal Code | C57BL/6 | |
| Submitter | Ichikawa Shinichi | |
| Submitter affiliation or code | Niigata University of Pharmacy and Applied Life Sciences | |
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | GPP34 |
| Gene name | Golgi-associated protein of 34kDa |
| Allele symbol | Tg(GPP34) |
| Allele name | |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| pBROAD2-2702bp | gatctcgtcatcgcctccatg |
| RV-GPP34 | aagaacatcccctgttggagca |
| FW-GPP34 | ggaatccattaaaattgcattatc |
| RV-pBROAD2 2970bp | ggcagaatccagatgctcaag |
| Disease name, Applicable field |