| CARD ID | 2347 | |
| Type of strain | Transgenic. | |
| Strain name | STOCK-Tg(Krt19-Cre/ERT) | |
| Internal Code | K19CreERT | |
| Submitter | Kume Shoen | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | CreERT |
| Gene name | Cre recombinase fused to a triple mutant form of the human estrogen receptor |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | 17 , |
| Gene classification | Gene to express(transgenic) |
| Method | |
| OMIM |
| Pr3 | GCAGAATCGCCAGGAATTGACC |
| Pr2 | GTTCTTGCGAACCTCATCACTC |
| Author | Anna L. Means, Yanwen Xu, Aizhen Zhao, Kevin C. Ray, and Guoqiang Gu |
| Title | A CK19CreERT knockin mouse line allows for conditional DNA recombination in epithelial cells in multiple endodermal organs. |
| Journal | Genesis.June |
| Volume | 46(6) |
| Page | 318–323 |
| Year | 2008 |
| PMID |
| Disease name, Applicable field | Development |