| CARD ID | 653 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Stxbp3tm1 | |
| Internal Code | ||
| Submitter | KANDA Hajime | |
| Submitter affiliation or code | Kobe University School of Medicine | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kobe University Graduate School of Medicine |
| Organization code | ||
| Developer | Shinoda Akihiro | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | stxbp3 |
| Gene name | stxbp3(syntaxin binding protein 3) |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | 3 , 3 , 3 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM | OMIM ID: 608339 Human Gene Symbol: STXBP3, |
| TCGTGCTTTACGGTATCGCCGCTCCCGATT | |
| TGGCAGACCTAGGTTTGGTGTC |
| Author | |
| Title | |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Disease name, Applicable field | Development, Neurobiology, Metabolism |