CARD R-BASE



Mouse strain


Strain information

CARD ID 1152
Type of strain Targeted mutant.
Strain name STOCK Canxtm1Osb
Internal Code Canx-tm2
Submitter Masaru Okabe
Submitter affiliation or code Genome Information Research (enter Osaka University)
Stock Type
Material Transfer Conditions Consent to us
The RECIPIENT must contact the person listed below in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES. mta-egr@biken.osaka-u.ac.jp (Contact to Masahito Ikawa)
Production method in-house breeding
Origin (In-house) Organization Research Institute for Microbial Diseases, Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Canx
Gene name calnexin
Allele symbol Canxtm1.1Osb
Allele name calnexin; targeted mutation 1.1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:88261,
Chromosome 11 (30.46) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
1072 gctctggatgccttgggatttgatttc
1074 ggatttagtggatatccccagtatgagc


References

Author Tokuhiro K1, Satouh Y1, Nozawa K1,2, Isotani A1,3,4, Fujihara Y1, Hirashima Y5, Matsumura H1,4, Takumi K1,4, Miyano T5, Okabe M1, Benham AM1,6, Ikawa M1,2,3,4.
Title Calreticulin is required for development of the cumulus oocyte complex and female fertility.
Journal Sci Rep.
Volume 5
Page 14254
Year 2015
PMID


Disease , Applicable field information

Disease name, Applicable field Immunology, Neurobiology, Metabolism






Copyright @ 2021 Kumamoto University. All rights reserved.