CARD ID | 379 | |
Type of strain | Targeted mutant. | |
Strain name | STS.B6CB-Trp53tm1Sia | |
Internal Code | STS/A-p53+/KO, STS.B6CB-Trp53tm1Sia | |
Submitter | Unknown Unknown | |
Submitter affiliation or code | ||
Stock Type | ||
Material Transfer Conditions |
No condition
|
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | Shiro Aizawa |
Organization code | ||
Developer | National Institute of Radiological Sciences | |
Year introduced | 2001 / 9 | |
Introduced Generation | N17 | |
Remarks |
Gene symbol | Trp53 |
Gene name | Transformation related protein 53 |
Allele symbol | Trp53tm1Sia |
Allele name | Trp53, targeted mutation 1, Shinichi Aizawa |
MGI | MGI:98834, |
Chromosome | 11 , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
GO | Gene Ontology |
OMIM | OMIM ID: 191170 Human Gene Symbol: TP53, |
primerA | 5'(aattgacaagttatgcatccatacagtaaca)3' |
primerB | 5'(actcctcaacatcctggggcagcaacagat)3' |
Author | M Okumoto, R Nishikawa, S Imai and J Hilgers |
Title | Genetic analysis of resistance to radiation lymphomagenesis with recombinant inbred strains of mice |
Journal | Cancer Research |
Volume | 50 |
Page | 3848-3850 |
Year | 1990 |
PMID | 2354437 |
Author | Okumoto M, Nishikawa R, Imai S, Hilgers J. |
Title | Resistance of STS/A mice to lymphoma induction by X-irradiation. |
Journal | J Radiat Res (Tokyo) |
Volume | 30 |
Page | 135-139 |
Year | 1989 |
PMID | 2769623 |
Disease name, Applicable field | cancer |