| CARD ID | 2048 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Plagl1tm1 | |
| Internal Code | C57BL/6-Zac1 flox | |
| Submitter | Hironori Ueda | |
| Submitter affiliation or code | Kwansei Gakuin University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Molecular Endocrinology, Graduate School of Medicine, Osaka University |
| Organization code | ||
| Developer | UEDA, HIRONORI | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Plagl1 |
| Gene name | Pleiomorphic adenoma gene-kike 1 |
| Allele symbol | Plagl1tm1 |
| Allele name | pleiomorphic adenoma gene-like 1, targeted mutation 1 |
| MGI | MGI:1100874, |
| Chromosome | 10 (4.72) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Zac1-flox-F | GGACTCGTCTATAAGAAATGGACAG |
| Zac1-flox-R | ATGAAGTCGTAACTCACATTGGAAC |
| Disease name, Applicable field | Immunology, Genetics, Cell biology, Development, Molecular biology, Ophthalomology, Osteosis, Hematology, Digestive Disorders, Reproduction, Metabolism, Endocrine Disorders, Neurobiology, peromelia, cancer, Diabetes, Aging, Respiratory System |