CARD ID | 1884 | |
Type of strain | Targeted mutant. | |
Strain name | B6;129-Spink3tm1(SPINK1) Card | |
Internal Code | SPINK1 knockin mouse | |
Submitter | Ken-ichi YAMAMURA | |
Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Center for Animal Resources & Development (CARD), Kumamoto University |
Organization code | Card | |
Developer | Ken-ichi Yamamura | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Spink 1 |
Gene name | serine protease inhibitor Kazal type 1 |
Allele symbol | |
Allele name | serine protease inhibitor Kazal type 1, targeted mutation 1, Naomi Nakagata, Center for Animal Resources and Development |
MGI | MGI:106202, |
Chromosome | 18 (23.47 ) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
SPINK1-1-1 | gaaggtaacaggcatctttcttctc |
SPINK1-1-2 | atctctttacctctcttcccaggg |
Author | Wang J, Ohmuraya M, Hirota M, Baba H, Zhao G, Takeya M, Araki K, Yamamura K |
Title | Expression pattern of serine protease inhibitor kazal type 3 (Spink3) during mouse embryonic development. |
Journal | Histochem Cell Biol. |
Volume | 130 |
Page | 387-97 |
Year | 2008 |
PMID |
Author | Ohmuraya M, Hirota M, Araki M, Mizushima N,Matsui M, Mizumoto T, Haruna K, Kume S, Takeya M, Ogawa M, Araki K, Yamamura K. |
Title | Autophagic cell death of pancreatic acinar cells in serine protease inhibitor kazal type 3-deficient mice. |
Journal | Gastroenterology |
Volume | Aug;129(2) |
Page | 696-705 |
Year | 2005 |
PMID | 16083722 |
Disease name, Applicable field | Laboratory-animal Science |