CARD R-BASE



Mouse strain


Strain information

CARD ID 1848
Type of strain Targeted mutant.
Strain name C57BL/6-Clec1atm1Yiw
Internal Code Clec1a KO
Submitter Iwakura Yoichiro
Submitter affiliation or code Division of Laboratory Animal,Research Institute for Biological Sciences, Tokyo University of Science
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Research Institute for Biomedical Sciences, Tokyo University of Science
Organization code Yiw
Developer Yoichiro Iwakura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Clec1a
Gene name C-type lectin domain family 1, member a
Allele symbol
Allele name C-type lectin domain family 1, member a, targeted mutation 1, Yoichiro Iwakura, University of Tokyo
MGI
Chromosome 6 (63.32) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Clec1a-Common gtgaataatgcgttgctctctgcc
Clec1a-WT gatgtgctcagattgctcgagagg
PCR Primer 2
Clec1a-Common gtgaataatgcgttgctctctgcc
EGFP-R1 ctgaacttgtggccgtttacgtcg


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.